pg_bio Video Library & Interactive 3D Multiomics Explorer
𧬠Hello World, pg_bio! β Biotech & Multiomics in PostgreSQL
Navigate the interactive HTML lessons, rotate real 3D protein structures in 3Dmol.js, toggle between βοΈ Systems Engineer and 𧬠Structural Biologist mental models, and keep the π Voiced Hovering Video Companion floating in the corner as you explore.
Ep 1: Hello World, pg_bio! The Central Dogma in SQL
βοΈ Systems Engineering Lens: PostgreSQL 1D int4range GiST overlap (&&) and distance (<->) operators scan billions of base pairs, while single-pass Rust byte slices compute bio_translate_dna(), isoelectric_point(), and gravy_score() in 200 ns.
π» Live PostgreSQL 18 Query
bio_demo=# SELECT
bio_translate_dna('ATGTTCGAAGGTTTCGAACGTCGT') AS peptide_seq,
round(isoelectric_point('MFEGFERRLVDWPSTDK')::numeric, 2) AS pI_charge,
round(gravy_score('MFEGFERRLVDWPSTDK')::numeric, 3) AS hydropathy,
round(sequence_entropy('MFEGFERRLVDWPSTDK')::numeric, 3) AS shannon_bits,
prosite_match('MFEGFERRLVDWPSTDKHCH', 'H-x-H') AS metal_motif
WHERE int4range(10500, 11800) <-> int4range(8000, 9200) < 5000;
π¬ Interactive 3D Structure Stage (3Dmol.js)
πΊ Series 01 Episodes β Click Any Episode to Load Video, SQL & 3D View
Ep 1: Hello World, pg_bio! The Central Dogma in SQL
DNA → RNA → Protein compilation, 1D int4range GiST genomic safe harbors, Henderson-Hasselbalch isoelectric_point, and Kyte-Doolittle gravy_score.
Ep 2: From 1D Strings to 3D Atoms with Morton Curves
How z_order_encode(x, y, z) weaves 3D Angstrom coordinates into a 64-bit B-Tree integer and theozyme_rmsd runs 3×3 Jacobi SVD in SQL.
Ep 3: Transcriptomics & CSR Sparse Attention Graphs
Compressing 20-billion-cell single-cell RNA matrices and 500 ns MD free-energy networks into SparseAttentionMap CSR arrays to uncover cryptic pockets.
Ep 4: The Multiomics Holy Grail β Vectors & Live UniProt
1280-D halfvec HNSW cosine search (<=>), Twilight-Zone Smith-Waterman DP re-ranking, and live REST enrichment via bio_fetch_uniprot().